Chromosome segment duplications in Neurospora crassa and their effects on repeat- induced point mutation (RIP) and meiotic silencing by unpaired DNA

The size and extent of four Neurospora crassa duplications, Dp(AR17), Dp(IBj5), Dp(OY329) and Dp(B362i) was determined by testing the coverage of RFLP markers. The first three duplications were all > ~350 kb and have been shown in earlier studies to act as dominant suppressors of repeat-induced point mutation (RIP) in gene-sized duplications, possibly via titration of the RIP machinery. Dp(B362i), which is only about 117 kb long, failed to suppress RIP. RIP suppression in gene-sized duplications by large duplications was demonstrated using another test gene, dow, and supposedly applies generally. Crosses homozygous for Dp(AR17) or Dp(IBj5) were as barren as heterozygous crosses. Barrenness of the heterozygous but not the homozygous crosses was suppressible by Sad-1, a semidominant suppressor of RNAi-dependent meiotic silencing by unpaired DNA. A model is proposed in which large duplications recessively suppress semi-dominant Sad-1 mutations. The wild-isolated Sugartown strain is hypothesized to contain a duplication that confers not only dominant suppression of RIP but also a barren phenotype, which is linked (9%) to supercontig 7.118 in LG VII. (170 words) INTRODUCTION In the fungus Neurospora crassa crosses heterozygous for a chromosome segment duplication are generally barren, that is, they make normal looking perithecia but yield very few ascospores (see PERKINS, 1997 for a review). Barrenness is caused by a recently discovered gene silencing process called meiotic silencing by unpaired DNA (also known as MSUD, but since this is also the acronym for “Maple Syrup Urine Disease”, the term “meiotic silencing” is preferred), an RNAi-based mechanism that silences genes that are unpaired in meiosis (SHIU et al., 2001; SHIU and METZENBERG, 2002). Consequently, it also silences all homologues of the unpaired genes, regardless of whether or not the homologues are themselves paired. Since in a duplication-heterozygous cross one copy of each duplication-borne gene is unpaired in meiosis, all the duplication-borne genes, including any required for ascus development and meiosis, are silenced and the cross is rendered barren. The genes Sad-1, Sms-2, RecQ-2 and Sms-3 encode the RNA-dependent RNA polymerase (RdRP), argonaute, RecQ DNA helicase, and dicer enzymes used in meiotic silencing. Semi-dominant mutants of Sad-1 and Sms-2 suppress meiotic silencing and can increase the productivity of duplication-heterozygous crosses (SHIU et al., 2001). The semi-dominant alleles are either complete or partial deletions of the sad-1 or sms-2 genes, or their sequence is so severely altered by point mutations that they probably fail to pair with their wild-type homologues and thus induce self-silencing (SHIU and METZENBERG, 2002; LEE et al., 2004). Homozygosity for sad-1 (or sms-2) mutants causes infertility. Repeat-induced point mutation (RIP) is a silencing process that protects the Neurospora genome against the proliferation of transposable elements and other parasitic DNA sequences (for a recent review see GALAGAN and SELKER, 2004). RIP occurs in the premeiosis of a sexual cross and induces hypermutation and methylation of any sizeable DNA sequence that is duplicated in an otherwise haploid genome (SELKER, 1990). The RIP-defective (rid) gene encodes a cytosine methyltransferase homologue essential for RIP, and RIP does not occur in crosses homozygous mutant for rid (FREITAG et al., 2001). The efficacy of RIP is attested by the fact that the N. crassa genome contains no active transposable elements, although it does contain RIP-inactivated relics of such elements (GALAGAN et al., 2003). Previous work from our laboratory showed that 1 or 2% of wild-isolated N. crassa strains display a dominant RIP suppressor phenotype (NOUBISSI et al., 2000; NOUBISSI et al., 2001; BHAT et al., 2003). One dominant RIP suppressor strain (Adiopodoume) is the only Neurospora strain known to harbor an active transposable element, called Tad (KINSEY, 1989; KINSEY and HELBER, 1989). Spread of Tad into other strains is apparently restricted by RIP. In another suppressor strain (Sugartown), the suppressor phenotype was linked to a barren phenotype in crosses, suggesting that the Sugartown strain might contain a naturally occurring duplication that causes both suppression of RIP and barrenness. The barren phenotype segregated independently of markers on all linkage groups (LGs) except LG VII (BHAT et al., 2003). We have now tested for linkage of the barren phenotype with molecular markers in LG VII. Strains bearing chromosome segment duplications can be obtained in the laboratory as segregants from crosses between strains that are heterozygous for rearrangements such as insertional translocations (PERKINS, 1997). We have demonstrated that large segmental duplications are capable of dominantly suppressing RIP of genes in a smaller duplication, presumably by titrating out the RIP machinery (BHAT and KASBEKAR, 2001; FEHMER et al., 2001). How large must a duplication be to function as a dominant RIP suppressor? The size of one N. crassa duplication, Dp(AR18), was estimated from orthogonal field agarosegel electrophoresis studies to be 270 kb + 90 kb (SMITH and GLASS, 1996). Here we show that Dp(AR18) is capable of dominant RIP suppression. Two developments have now made it possible to determine the size and extent of any N. crassa duplication with an unprecedented precision. First, the sequencing of the N. crassa genome makes it easy to amplify practically any genomic segment by PCR. Second, the collection of N. crassa wild isolates from all over the world (> 400 available from the Fungal Genetics Stock Center; PERKINS and TURNER, 1988; TURNER et al., 2001) offers an excellent resource for identifying DNA sequence polymorphisms (e.g., RFLPs) with the amplified DNA as probe. Duplication progeny from crosses between the translocation and the wild-isolated strains are expected to display both parental alleles of any RFLP that lies within the translocated segment. Whereas for RFLPs that map just outside the translocated segment, the duplication progeny should exhibit only the allele from the wild-isolated parent. Thus the extent of duplication coverage can be determined by analyzing a series of RFLPs that correspond to linked genomic segments. Using this approach we characterized four duplications, Dp(AR17), Dp(B362i), Dp(IBj5) and Dp(OY329) . Three of them were shown previously to act as dominant suppressors of RIP (BHAT and KASBEKAR, 2001; FEHMER et al., 2001). The fourth, Dp(B362i), was tested in this work. The dominant RIP suppressor phenotypes were identified in screens that tested for the suppression of RIP in a small fragment carrying the erg-3 gene (NOUBISSI et al., 2000; BHAT and KASBEKAR, 2001; FEHMER et al., 2001; NOUBISSI et al., 2001; BHAT et al., 2003). In these screens, the frequency of RIP-induced erg-3 mutant progeny was scored in crosses that were heterozygous for the duplicated erg-3 gene fragment and that did or did not carry the larger duplication being tested for ability to suppress RIP. Crosses with nonsuppressor strains typically yield RIP-induced erg-3 mutant progeny at frequencies in the 225% range, but in the crosses with the suppressing duplications the frequency of RIPinduced mutant progeny was < 0.5%. We have now verified that the low RIP frequencies are not peculiar to the erg-3 duplication but also extend to other duplicated sequences; specifically, to a duplicated fragment of the downy (dow) gene. Relatively few reports have described crosses homozygous for chromosome segment duplications. Patricia St. Lawrence had examined T(IR;II;IVR;VL)R55, a complex rearrangement involving four chromosomes, in her Ph.D thesis and found that crosses homozygous for Dp(R55) were at least as barren as crosses heterozygous for the duplication (St. LAWRENCE, 1953; summarized by PERKINS, 1997 and RAJU and PERKINS, 1978). Another complex rearrangement, T(IVR >VIIL;IL;IIR;IVR)S1229, arg-14 was studied by Edward Barry in his Ph.D. thesis and he found that crosses homozygous for Dp(S1229) were as barren as the heterozygous crosses. Very few progeny were produced, but these were barren like their parents, indicating that the duplication was stable and was transmitted through meiosis. (BARRY, 1960, summarized by RAJU and PERKINS, 1978). RAJU and PERKINS (1978) examined homozygous crosses of Dp(IVR >IIIR)S4342 and Dp(VL > IVL) AR33. These were barren like the corresponding heterozygous crosses to wild type. More recently, BHAT and KASBEKAR (2004) reported that homozygosity for Dp(AR17) caused a barren phenotype. A priori the duplication-borne genes were not expected to be unpaired in any of these crosses. Moreover, the barrenness of the Dp(AR17) homozygous duplication cross differed from that of the heterozygous cross in that it was not suppressible by a semidominant Sad-1 mutation. SHIU et al., (2001) also noted that the Sad-1 mutation fails to confer fertility to duplication-homozygous crosses. We report here that homozygosity for Dp(IBj5) or Dp(B362i) also results in a barrenness that is not effectively suppressed by Sad1. MATERIALS and METHODS Strains from other collections: The following N. crassa strains were obtained from the Fungal Genetics Stock Center (FGSC), University of Missouri, Kansas City, MO 64110: the standard wild types 74-OR23-1 A (FGSC 987) and OR8-1 a (FGSC 988); and the mutant strains erg-3 a (FGSC 2725), erg-3 A (FGSC 3439), and dow a (FGSC 4052), all in Oak Ridge background. The wild-isolated strains Adiopodoume A (FGSC 430) and its derivative T-430-Hygr a (FGSC 8609), Adiopodoume-7 (P4305), Bayan Lepas (P2663), Bichpuri-1 (P0753), Coon (P0881), Franklin (P4467), Franklin (P4490), Fred (P1138), Lankala Koderu-1 (P1110), Mughalsarai-2 (P0736), and Sugartown (P0854). The T-430-Hygr a strain was derived from Adiopodoume A by replacement of the mat A idiomorph by transformation with DNA of the mat a idiomorph (ANDERSON et al., 2001). The Adiopodoume A and T-430-Hygr a display a dominant RIP-suppressor phenotype linked to mat on LG IL (BHAT et al., 2003). The Adiopodoume-7, Bayan Lepas, Coon, Fred and Sugartown strains also have a dominant RIP suppressor phenotype (NOUBISSI et al., 2000; NOUBISSI et al., 2001; BHAT et al., 2003). The translocation strains T(IIIR>[IR;IIR]) AR17 A (FGSC 2442), T(IIIR>[IR;IIR]) AR17 a (FGSC 1463), T(IIL>IIIR) AR18 A (FGSC 2643), T(IIL>IIIR) AR18 a (FGSC 2644), T(IVR>I)B362i A (FGSC 2935), T(IVR>I)B362i a (FGSC 2988), T(VIL>IR)IBj5, cpc-1 A (FGSC 4433), T(VIL>IR)IBj5, cpc-1 a (FGSC 4434), T(VIR>IIIR) OY329 A (FGSC 3670) and T(VIR>IIIR) OY329 a (FGSC 3671) and the duplication strains Dp(IVR>VII) S1229 A (FGSC 264) and Dp(IVR>VII) S1229 a (FGSC 265). Translocations T(IIIR>[IR;IIR]) AR17, T(IIL>IIIR) AR18, T(IVR>I)B362i, T(VIL>IR)IBj5 and T(VIR>IIIR) OY329 will henceforth be referred to as T(AR17), T(AR18), T(B362i), T(IBj5) and T(OY329) respectively and duplications obtained as progeny from them will be symbolized Dp(AR17), Dp(AR18), etc. The translocations and duplications have been described (PERKINS, 1997). Mutations in the RIP-defective (rid) gene cause a recessive defect for RIP and the strains rid-1 A (N1977) and rid-1 a, hygr (N2148) were kind gifts from Eric U. Selker. The semi-dominant suppressor of meiotic silencing by unpaired DNA Sad-1, (SHIU et al., 2001; SHIU and METZENBERG, 2002), was used to overcome the barren phenotype of crosses involving duplication strains. The strains Sad-1 A (FGSC 8740), Sad-1 a (FGSC 8741), Sad-1 rid A (33-10) and Sad-1 rid a (33-11) were kindly provided by Robert L. Metzenberg. Strains made previously in our laboratory: The Dp1.3ec hph A and a strains have been described (PRAKASH et al., 1999; BHAT et al., 2003). The transgene Dp1.3ec hph, contains a 1.3 kb HindIII fragment of the LG IIIR gene ergosterol-3 (erg-3, encoding the sterol biosynthetic enzyme sterol C-14 reductase), and is tagged with the bacterial hph gene which confers resistance to hygromycin. The transgenic fragment does not encode a functional enzyme but serves to target RIP during a cross. The resulting RIP-induced erg-3 mutant progeny can be easily scored under a dissection microscope by their distinct colony morphology on Vogel’s sorbose agar medium (NOUBISSI et al., 2000). The Dp1.3ec hph A and a strains were crossed with other strains listed above to construct the following strains in both mating types rid; Dp1.3ec hph, Sad-1; Dp1.3ec hph, and Sad-1 rid; Dp1.3ec hph. Strain 22, a Sad-1 a segregant from the cross Sugartown A x Sad-1; Dp1.3ec hph a, was confirmed to have inherited the dominant RIP suppressor phenotype of its Sugartown parent. The duplication strains Dp(AR17), Dp(AR18), Dp(B362i), Dp(IBj5), and Dp(OY329) were obtained from crosses between the translocation strains and normal sequence strains (OR, dow, or the wild-isolates) whereas the Dp(S1229) strains were obtained from the FGSC. The duplication strains were barren in crosses with euploid strains of the opposite mating type. The construction of Dp(AR17), dow+/dow, rid-1; Dp(AR17), dow+/dow, and Sad-1 ; Dp(AR17), dow+/dow in both mating types is described by BHAT (2004). The Sad-1 rid; Dp(AR17), dow+/dow strains were constructed in an analogous manner. Growth, crosses, ascospore collection and scoring of RIP frequencies: Crossing and maintenance of Neurospora strains was essentially as described by DAVIS and DE SERRES (1970). Crosses were performed by confrontation between mycelia inoculated as plugs on synthetic crossing medium in petri dishes. Ascospores began to be shot within 1618 days and were harvested by washing the lids with ~ 1 ml water. The frequency of erg-3 mutant progeny was scored under a dissection microscope as the proportion of colonies with the mutant morphology. In this article the frequency of erg-3 mutant progeny is used as a measure of RIP efficiency. It is known that the frequency of RIP increases with the age of the cross (SINGER et al., 1995). Therefore the erg-3 mutation frequencies were determined in ascospores harvested at 31 days by which time RIP frequencies have plateaued. PCR amplification, other molecular methods and transfomation: PCRs were performed using custom oligonucleotide primers purchased from Bioserve (India). The reaction conditions used, other molecular methods and transformation protocols were essentially the same as previously described (BHAT et al., 2004). Construction of Dp1.5dowec hph strains: A 4921 bp gene encoding the hypothetical protein, designated NCU08565.1, had been identified in contig 3.520 (in distal LG IIIR) of the N. crassa genome sequence (release 3). This gene is flanked by the markers ropy-11 (ro-11) and sulfur control-2 (scon-2), both of which are covered by the duplication Dp(AR17). The downy (dow) locus also maps to this region, therefore we tested whether NCU08565.1 was in fact the dow gene. A 1421 bp fragment of NCU08565.1 was amplified by PCR using the primers MV1 (5’ CATTCAGCTTCGACAGGACA) and MV2 (5’ CTGGCGGTATCTTCTTCAGC). The 5’ terminal nucleotide of MV1 is base 13822 of the contig sequence and the 5’ terminal nucleotide of MV2 is the complement of base 15243. The amplified DNA was cloned into the plasmid vector pCSN44 and transformed by electroporation into conidia of the strain erg-3 a. Crosses made with the transformant strains produced many dow mutants among the progeny and Southern analysis revealed that in many of the dow mutants the NCU08565.1 gene sequence had suffered both mutation and cytosine-methylation as would be expected from RIP mutagenesis (data not shown). These results showed that NCU08565.1 is indeed the dow gene. A transgene from one of the transformants that was unlinked to mat or erg-3 was designated Dp1.5dowec hph. This transgene was used to obtain Dp1.5dowec hph or Dp1.5dowec hph; erg-3 segregants in both mating types. We also used it to construct the Sad-1; erg-3; Dp1.5dowec hph A strain. Localization of breakpoints: The markers downy (dow), methionine-1 (met-1), yellow-1 (ylo-1) and tryptophan-2 (trp-2) are contained, respectively, within the duplicated segments of Dp(AR17), Dp(B362i), Dp(IBj5) and Dp(OY329) (PERKINS, 1997), and the gene sequence for these markers is known. The oligonucleotide primers used for PCR amplification of ~2-3 kb segments of each marker gene are listed in Supplementary Table 1. The amplified segments were used to probe Southern blots of restriction digested genomic DNA from the relevant translocation (T) strains (i.e., T(AR17), T(B362i), T(IBj5) and T(OY329) ) and wild-isolated (W) strains to identify RFLPs that molecularly distinguish between the marker alleles in T and W. Duplication (Dp) progeny from T x W were identified by their barren phenotype in crosses with OR strains and Southern analyses was done to confirm that Dp strains contained both the T and W alleles of the relevant RFLPs identified above. In this way for each Dp we established molecular evidence for an “initial duplicated marker” within the duplicated segment. Next, we identified additional RFLPs between T and W at distances of say, approximately 100 kb from the initial duplicated marker. The presence in the Dp of both alleles (T and W) of the new RFLP indicated that the duplication extended to the genomic segment marked by that RFLP, but if the Dp exhibited only one allele (W, in the absence of crossovers) then the duplication did not extend to the RFLP. In this way each duplication breakpoint could be localized to a genomic interval bracketed by RFLP markers at most ~100 kb apart. Subsequent iterations of this approach with additional RFLPs sub-divided the ~100 kb interval into progressively narrower intervals until each breakpoint was localized to an interval bracketed by RFLP markers that were only about 3-5 kb apart. Table 2 presents a schematic diagram of this approach. The solid box represents the initial duplicated marker used to define each duplication (i.e., dow /Dp(AR17), met1/Dp(B362i), ylo-1/Dp(IBj5) and trp-2 /Dp(OY329) ). ‘D’ represents the distance from the first nucleotide of the start codon to the third nucleotide of the stop codon. Two hatched boxes represent the genomic segments (designated inner and outer probes) that bracket each breakpoint. The inner probes detect the farthest RFLPs that are covered by the duplication whereas the outer probes detect the closest RFLPs that are not covered. The primers to amplify these probe and the enzymes and W strains used to detect the RFLPs are summarized in Supplementary Table 1. AL and AR denote the distances from the marker gene ORF to the farthest nucleotides of the inner probes and BL and BR that to the closest nucleotides of the outer probes. The minimum size of the duplication can be defined by (AL + D + AR) and the maximum size by (BL + D + BR). Southern analysis was done to verify that the T and the OR strains from which the translocations were derived indeed displayed an RFLP in the identified interval. This RFLP was presumably caused by the duplication breakpoint. Mapping of the Sugartown barren phenotype: The barren phenotype of the Sugartown strain was previously shown to segregate with markers on LG VII (BHAT et al., 2003), therefore we tested its linkage with molecular markers in the LG VII genome sequence that showed polymorphisms between the Sugartown and OR strains. In release 7 of the N. crassa genome sequence (www.broad.mit.edu/cgibin/annotation/fungi/neurospora_crassa_7) seven supercontigs have been assigned to LG VII. Four supercontigs (7.21, 7.55, 7.10 and 7.52) are “well-ordered” and contain 2.05 Mb of sequence whereas three (7.23, 7.73 and 7.118) are not well-ordered and contain 0.69 Mb. Well-ordered supercontigs have their relative order assigned with respect to the genetic map. The not well-ordered supercontigs do not contain any well-ordered markers to make such assignments. The oligonucleotide primers used for PCR amplification of 19 different genomic segments from these supercontigs as well as the restriction enzyme used to distinguish between the Sugartown (S) and OR (O) alleles of the amplified fragment are listed in Supplementary Table 2. The segregation of these alleles was examined among 124 progeny from the Sugartown x ORa cross for linkage with the barren phenotype. Those with the S allele and barren phenotype or O allele and a fertile phenotype were the parental types, whereas those with the O allele and barren phenotype or S allele and fertile phenotype were the cross-overs. Supplementary Table 2 also lists the frequency of cross-over types obtained for each molecular marker. Construction of Dp(IBj5) strains: Dp(IBj5) strains of both mating types were obtained from crosses between T(IBj5) A x ORa or T(IBj5) a x ORA. They were identified by their barren phenotype in crosses with OR strains and subsequently confirmed by Southern analysis with a fragment from the cpc-1 gene that straddles the breakpoint, as probe. rid ; Dp(IBj5) strains in both mating types and the Sad-1 rid; Dp(IBj5) A strain were obtained from T(IBj5) A x rid a, T(IBj5) a x rid A and T(IBj5) a x Sad-1 rid A and identifying segregants with the mating type of the non-translocation parent. The duplication in rid; Dp(IBj5) strains was confirmed both by its barren phenotype and by Southern analysis. The presence of rid was confirmed by recovering the mutant allele in a subset of non-duplication progeny from crosses with these strains and then confirming that crosses with rid; Dp1.3ec hph strains produce no erg-3 mutant progeny. The presence of Sad-1 in the Sad-1 rid; Dp(IBj5) A strain was confirmed by verifying infertility in a cross with Sad-1 a. The presence of Dp(IBj5) was confirmed by Southern analysis and the presence of rid was confirmed as for the rid; Dp(IBj5) strains. RESULTS Dominant suppression of RIP in dow: The wild-isolated strains Adiopodoume A (FGSC 430), and its derivative strain T-430-Hygr a (FGSC 8609), Sugartown A (P0854), Adiopodoume-7 A (P4305), Fred a (P0833), Coon a (P0881) and Bayan Lepas a (P2663) were shown previously to dominantly suppress RIP in a duplication of the erg-3 gene fragment (NOUBISSI et al., 2000; NOUBISSI et al., 2001; BHAT et al., 2003). A similar dominant RIP suppressor phenotype was also displayed by segregants bearing the chromosome segment duplications Dp(AR17), Dp(IBj5), Dp(OY329) or Dp(S1229) (BHAT and KASBEKAR, 2001; FEHMER et al., 2001). We wanted to test whether these dominant RIP suppressor phenotypes also extend to other duplicated sequences; specifically, to a duplicated fragment of the downy (dow) gene. For this, each suppressor strain was crossed with Dp1.5dowec hph; erg-3 strains of the opposite mating type. Dp1.5dowec hph is a tagged duplication that targets RIP to dow (see Materials and Methods). The dow locus is linked to erg-3 (~10%) therefore any dow mutants induced by RIP in these crosses would be recovered amongst the erg-3 progeny. For controls, the Dp1.5dowec hph; erg-3 strains were crossed with the Oak Ridge (OR) strains 74-OR23-1 A and OR8-1 a. The RIP suppressor of the Sugartown strain was tested using a Sad-1 segregant (strain 22) from a cross between Sugartown and a Sad-1 mutant strain (see Materials and Methods). The Sad-1 mutation overcomes the barren phenotype characteristic of crosses with the Sugartown strain. The frequencies of RIP-induced dow mutants recovered in the erg-3 progeny from these crosses are summarized in Table 1. As can be seen in the Table, a sizable fraction of erg-3 segregants from the control crosses were mutant in dow. In contrast, no dow mutants were detected amongst the erg-3 progeny examined from the crosses involving Adiopodoume A, T-430-Hygr a, strain 22, Fred and Coon. Based on these results we can conclude that the dominant RIP suppressors of the Adiopodoume, Sugartown, Fred and Coon strains are capable of suppressing RIP in any duplication. However, the crosses with the Adiopodoume-7 and Bayan Lepas strains did produce some dow mutant progeny. It is possible that these two wild-isolated strains do not suppress RIP as effectively as the other four wild isolates. No dow mutants were found amongst the erg-3 segregants from the crosses heterozygous for Dp(AR17), Dp(IBj5), Dp(OY329) or Dp(S1229). This confirmed that the large duplications, as well as fairly small ones, also are capable of dominantly suppressing RIP in many, and possibly all gene-sized duplications. The Sad-1; Dp(AR17) x Dp1.5dowec hph; erg-3 cross presented an interesting case. If we disregard cross-overs, dow mutants generated by RIP in Dp(AR17) are recoverable amongst the erg+ progeny, whereas those generated by RIP in the small duplication are recoverable amongst the erg-3 progeny. As can be seen in Table 1, no dow mutants were generated in the small duplication but they were indeed produced by RIP in Dp(AR17). This confirms that Dp(AR17) suppresses RIP in Dp1.5dowec. The size and extent of duplications: The proximal and distal breakpoints of the duplications Dp(AR17), Dp(B362i), Dp(IBj5) and Dp(OY329) were localized as outlined in the Methods section and a summary of these experiments is presented in Table 2. The results showed that the duplications were, respectively, 351-357 kb, 116-119 kb, 402-405 kb and 703-707 kb in size. This work also revealed the actual genomic segment that is covered by the duplications. The localization of the proximal (right) breakpoint of Dp(IBj5) in Table 2 was consistent with the one made by PALUH et al. (1990). More precise localizations could be achieved using oligonucleotides from within the CL and CR genomic intervals (see schematic figure in Table 2). If the oligonucleotides can prime PCR amplifications from both the OR and the translocation strains, it follows that they do not bracket the breakpoint. Conversely, if the primers fail to amplify from the translocation but do so from OR it would suggest that they bracket the translocation breakpoint. The oligonucleotides 5’ agaaaggctcttacacaaggtag and 5’ gtagcgaagtccaaatcatgaac from the CL interval of Dp(AR17) could prime the amplification of a 581 bp fragment using OR DNA as template, but no product was obtained with DNA from T(AR17) strains (data not shown). Thus the proximal break of Dp(AR17) appears to be in this 581 bp segment. In a like manner the distal break of Dp(AR17) was localized to a 90 bp segment that is defined by the oligonucleotides 5’ caagtgaaaagcaaaagattggt and 5’ attcttccacaactccatccttga from the CR interval of Dp(AR17). These results narrow down the range of Dp(AR17)’s size to 354,651 -355,230 bp. Tests of Dp(AR18) and Dp(B362i) for dominant RIP suppression: The three largest duplications in the studies described above (Dp(AR17), Dp(IBj5) and Dp(OY329)) were shown previously to be capable of dominant suppression of RIP. At ~117 kb Dp(B362i) is significantly smaller, therefore we examined whether it too was a dominant RIP suppressor. A cross was made between the translocation strain T(B362i) A and the wildisolated strain Lankala Koderu-1, and of 22 f1 segregants examined 13 were A and 9 a. Southern analysis using the met-1 gene fragment as probe revealed that three mat A segregants (3, 8 and 10) had the met-1 RFLPs of both parental strains thus indicating that they were genotypically Dp(B362i). Consistent with this indication, crosses of these segregants with ORa were barren. The frequency of erg-3 mutant progeny from crosses of the Dp(B362i) segregants with Sad-1; Dp1.3ec hph a were, respectively, 7.3% (284), 7% (240) and 6.2% (208). (Numbers in parenthesis indicate the number of f2 progeny examined.) This showed that Dp(B362i) does not suppress RIP in trans. Five hygromycin-resistant f2 progeny (3-4, 3-11, 8-8, 8-26 and 10-8) from the crosses between segregants 3, 8 and 10 and Sad-1; Dp1.3ec hph a were determined by Southern analysis to be genotypically Dp (B362i); Dp1.3ec hph A and one (8-5) was Sad-1; Dp (B362i); Dp1.3ec hph A. We verified that crosses between segregants 3-4, 3-11, 8-8, 826 and 10-8 and ORa were barren. These five segregants were crossed with Sad-1 a and the frequencies of erg-3 mutant progeny from these crosses were 5.4% (204), 5.8% (189), 7.3% (259), 5.1% (98) and 5.7% (207). These results show that Dp(B362i) also does not suppress RIP in cis. Thus we can conclude that the ~117 kb duplication fails to act as a dominant RIP suppressor. We also examined Dp(AR18) for the dominant RIP suppressor phenotype. First, to confirm that translocation T(AR18) itself does not possess this phenotype we did the cross T(AR18) a x Sad-1; Dp1.3ec hph A (in this cross the Sad-1 mutation is irrelevant). The frequency of erg-3 mutants among the progeny harvested at 31 days was 2.4% (N = 598). Next, we did the cross T(AR18) A x ORa and several f1 progeny from this cross were, in turn, crossed with OR and Sad-1; Dp1.3ec hph strains of the appropriate mating type. The f1 progeny that gave barren crosses with OR were assumed to be Dp(AR18) whereas those that gave fertile crosses could be either translocation or normal sequence euploid (E) strains. The frequencies of erg-3 mutant progeny from six different Dp(AR18) x Sad-1; Dp1.3ec hph crosses examined were all < 0.2%, whereas those from the two control E x Sad-1; Dp1.3ec hph crosses examined were 15% and 4.9%. These results show that Dp(AR18) functions as a dominant suppressor of RIP. Mapping the barren phenotype of Sugartown: We examined 124 f1 segregants from the cross Sugartown x OR a; 72 were fertile when crossed with euploid strains of the opposite mating type whereas 52 were barren. Of 59 fertile segregants that were examined for the dominant RIP suppressor phenotype 56 (95%) were phenotypically Sup+ (frequency of erg-3 mutant progeny >1.0%) and three (5%) had an intermediate phenotype (frequency of erg-3 mutant progeny 0.5 1.0%). Of the 40 barren segregants examined in a similar manner, 32 (80%) were Sup(frequency of erg-3 mutant progeny <0.5%), 7 (17.5%) were intermediate and one (2.5%) was Sup+. These results were consistent with previous studies in showing linkage between the suppressor and barren phenotypes. The barren phenotype segregates with markers on LG VII (spco-4 (28.6%), slo-2 (28.9%), BHAT et al., 2003), therefore we tested its linkage with 19 LG VII molecular markers that were polymorphic between the Sugartown and OR strains. We prepared genomic DNA from the 124 f1 segregants from Sugartown x OR a, and analyzed them for the segregation of the molecular markers as described in the Materials and Methods section. The results of this analysis are summarized in Supplementary Table 2. As can be seen in the Table the tightest linkage (~9% cross-overs) was observed with a marker on supercontig 7.118 and somewhat lower linkage (~20%) was seen with two markers on supercontig 7.73. Crosses homozygous for Dp(AR17), Dp(IBj5) or Dp(B362i): BHAT and KASBEKAR (2004) had shown that crosses that are either heterozygous or homozygous for Dp(AR17) have a barren phenotype and in both cases the barrenness was independent of RIP. Moreover, the barrenness of the heterozygous cross was suppressible by a semidominant Sad-1 mutation but that of the homozygous cross was not suppressible by Sad-1. We repeated these crosses and confirmed the earlier results. We extended this study by constructing strains of the genotype Sad-1 rid; Dp(AR17), dow+/dow and used them to make crosses that were homozygous for Dp(AR17) and either heterozygous for rid and Sad1 or homozygous for rid and heterozygous for Sad-1. The former cross was barren whereas the latter was fertile. That homozygosity for Dp(AR17) and heterozygosity for rid and Sad1 causes barrenness is not surprising because the rid mutation is recessive thus making these crosses essentially similar to ones that were homozygous for Dp(AR17) and heterozygous for Sad-1. However, the fertile phenotype of crosses homozygous for both Dp(AR17) and rid and heterozygous for Sad-1 was an unexpected result. To examine whether crosses heterozygous or homozygous for Dp(IBj5) show similar effects we constructed Dp(IBj5), rid; Dp(IBj5), Sad-1; Dp(IBj5) and Sad-1 rid; Dp(IBj5) strains in both mating types (see Materials and Methods) and did the crosses summarized in Table 3. As can be seen in the Table, both heterozygosity and homozygosity for Dp(IBj5) caused barrenness and in both cases the barrenness was independent of RIP (crosses 7 and 15). Moreover the barrenness of the heterozygous cross was suppressible by Sad-1 whereas that of the homozygous cross was not suppressible by Sad-1 (compare crosses 2 and 11 with 9, 10 and 12). These results parallel those seen in equivalent crosses with Dp(AR17). However, the cross #13 (Sad-1 rid; Dp(IBj5) x rid; Dp(IBj5)) was barren. Thus although the RIP-defect appeared to alleviate the inability of Sad-1 to suppress the barren phenotype of the Dp(AR17)-homozygous cross it did not do so for the Dp(IBj5)-homozygous cross. Finally, cross #16, which was heterozygous for Dp(AR17), Dp(IBj5) and Sad-1, was fertile. The combined size of the two duplications (753-762 kb) is greater than that of Dp(OY329) (703-707 kb). A cross was made between T(B362i) a and ORA and ten mat a segregants were obtained that were barren in crosses with euploid. We confirmed by Southern analysis that these segregants were genotypically Dp(B362i). Each of the ten segregants was also crossed with a Dp(B362i) A strain (#8, see above) and a Sad-1; Dp(B362i) A strain (#8-5, see above). All 20 Dp(B362i)homozygous crosses were barren. Thus crosses homozygous for Dp(B362i) are barren and the barren phenotype is not suppressed by Sad-1. However, we noticed a consistent difference in the (very limited) productivity of the crosses of the Dp(B362i) segregants with OR A, Dp(B362i) A and Sad-1; Dp(B362i) A. The crosses with ORA were the least productive, those with Dp(B362i) A were somewhat more productive and those with Sad-1; Dp(B362i) A were the most productive. In a blind test based solely on the productivity differences we could distinguish between the three cross types reasonably successfully (the genotypes of 26/30 crosses could be correctly assigned). In contrast had the assignments been made at random only ten crosses would be expected to be correctly genotyped. DISCUSSION Duplications as dominant suppressors of RIP: Of the six duplications tested thus far (Dp(AR17), Dp(AR18), Dp(B362i), Dp(IBj5), Dp(OY329) and Dp(S1229)), only one, Dp(B362i), failed to display the dominant RIP suppressor phenotype. The size of Dp(S1229) has not been determined but it is known that it covers the gene methyltryptophan resistant (mtr) and that it has a breakpoint that is inseparable from an arginine-14 (arg-14) mutation (PERKINS 1997). A gap of unknown size is present between the supercontigs that bear mtr and arg-14, but the known sequence between these two markers is 270388 bp. Therefore Dp(S1229) is at least 270 kb in size. Dp(AR18) was estimated to be 270 kb + 90 kb from the results of SMITH and GLASS (1996). Thus Dp(B362i) is the smallest of the six duplications tested for dominant RIP suppression. Our findings are consistent with the model that chromosome segment duplications in N. crassa can act as dominant suppressors of RIP, possibly by titrating out the RIP machinery, but with an added proviso that the titrating duplication is larger than 117 kb. A more precise determination of the threshold size above which duplications can suppress RIP might be achievable by studying the mitotic deletion derivatives of Dp(AR18). Such deletion derivatives can be obtained as “escapes” from het-6 incompatibility in Dp(AR18), het6OR/het-6PA partial diploids (SMITH et al., 1996). The deletions reportedly range in size from ~ 70-kb up to putatively the entire 270-kb duplicated segment, but always including a 35-kb region in which the het-6 incompatibility locus is located. The barren and suppressor phenotypes of the Sugartown strain: Of the 99 segregants examined from Sugartown x OR a, 88 showed the parental phenotypes (56 fertile/Sup+ + 32 barren/Sup-); 10 (three fertiles + seven barrens) were intermediate and therefore could not be classified as Sup+ or Sup-, and one was barren and Sup+. These results can be interpreted to support the model that the suppressor and the barren phenotype are both caused by a > 117 kb duplication in the Sugartown strain, provided we disregard the single barren Sup+ segregant as either an experimental artifact or as a deletion derivative that reduces the size of the duplication to below the threshold required for dominant RIP suppression. An alternative model is that the two phenotypes, though closely linked, are separable by crossing-over (~1%). To distinguish between these models we undertook to map the barren phenotype as a prelude to molecular characterization. Our results showed the barren phenotype was most tightly linked (9% cross-overs) with a marker on supercontig 7.118 and somewhat less tightly linked (20%) with two markers on supercontig 7.73. These two supercontigs are respectively 15.6 kb and 539 kb in size. Unfortunately, they are not yet well-ordered. As the sequences in supercontig 7.118 become ordered in future releases of the genome sequence the search for more tightly linked markers can be resumed using genomic DNA from the 124 segregants. As more tightly linked markers are identified the genomic segment that is responsible for the barren phenotype would be progressively narrowed down. Duplication homozygosity and meiotic silencing: The results described here together with those of BHAT and KASBEKAR (2004) show that crosses homozygous for Dp(AR17), Dp(B362i) or Dp(IBj5) are barren. In contrast, crosses homozygous for small gene-sized duplications were not barren even though the heterozygous cross could be barren (SHIU et al., 2001). BHAT and KASBEKAR (2004) hypothesized that when a large duplication is homozygous, the duplication-borne genes might be able to pair in meiosis with allelic or non-allelic “partners”, and this ability might even induce them to switch partners. If these genes became transiently unpaired during the switches they might trigger meiotic silencing and thus render the homozygous cross as barren as the heterozygous one. Gene-sized duplications might not switch partners in homozygous crosses or might do so in a way that does not trigger meiotic silencing. Interestingly, although the Dp(B362i)homozygous crosses were barren they were consistently more productive than the Dp(B362i)-heterozygous crosses. In other words, the behavior of Dp(B362i) was intermediate between that of the small gene-sized duplications used by SHIU et al., (2001) and the much larger duplications like Dp(AR17) and Dp(IBj5). The semi-dominant Sad-1 mutation suppressed the barrenness of the heterozygous but not the homozygous crosses. Although the possibility that the barren phenotype of the homozygous crosses might have a different provenance from that of the heterozygous crosses is not ruled out, our finding of an increased productivity of Dp(B362i)-homozygous crosses if they were also made heterozygous for Sad-1 supports the idea that meiotic silencing contributes to the barrenness of the duplication-homozygous crosses. Large duplications appear to exert a recessive suppression of the semi-dominant Sad-1 mutation, possibly by desensitizing the detection of unpairing at sad-1+ and thus rendering the Sad-1 allele recessive. Transient-unpairing and re-pairing of multiple duplication-borne genes in the duplication-homozygous cross might increase the “noise” and thus reduce the signal-to-noise ratio below the threshold required to detect the unpairing of sad-1+. In a like manner, large duplications might also recessively suppress other ascus-dominant mutations. The inability of Sad-1 to suppress the barren phenotype of the Dp(AR17)homozygous cross appeared to be alleviated if the cross was also made homozygous mutant for the recessive RIP-deficient gene rid. We suggest that the “noise” is reduced in the Dp(AR17)-homozygous cross in the absence of RIP (or RIP-associated cytosine methylation) thus allowing Sad-1 to suppress meiotic silencing. The occurrence of RIP might promote meiotic pairing between non-allelic partners, which were presumably paired for RIP already prior to meiosis. In contrast, non-RIPed sequences might tend to pair primarily with allelic partners. In other words, by tending to increase partner switching in this way, RIP would increase the noise. Presumably, noise reduction in the Dp(IBj5), rid-homozygous cross was insufficient to overcome the suppression of Sad-1 semi-dominance by Dp(IBj5). We thank Ranjan Tamuli for making and analyzing some of the crosses with the Dp1.5dowec hph strains and Bhavani Prasanna for technical assistance. We are grateful to David Perkins, and an anonymous reviewer, for critical inputs that spared us a shave by Occam’s Razor, and to Namboori Raju for comments and for providing references to earlier observations on homozygous duplication crosses. We thank Bob Metzenberg and Eric Selker for the several strains they sent us. Charges for strains obtained from the Fungal Genetics Stock Center (FGSC) were generously waived. The FGSC is supported by National Science Foundation grant BIR-9222772. MV was supported by a Senior Research Fellowship from the Council of Scientific and Industrial Research-University Grants Commission, New Delhi. CR was supported by grant number SP/SO/D18/2001 from the Department of Science and Technology, New Delhi to DPK.